per-sequence RNA secondary structure not always written to stockholm file

In version 2.10.1 (and most likely since 2.8.2), per-sequence RNA secondary structure is not included in stockholm formatted output files if the sequence associated RNA secondary structure annotation was added after features were created on the sequence (e.g. if an RNA 3D structure was loaded for the sequence and RNA 2D structure transferred).

Steps to reproduce:
1. import:
>Dm
AAACCCUUUUACACACGGGAAAGGG
2. Create a sequence feature anywhere on the sequence
3. Load attached jalview annotation file
4. Output in stockholm format