Details
-
Type:
Bug
-
Status: Open
-
Priority:
Blocker
-
Resolution: Unresolved
-
Affects Version/s: 2.9, 2.10.0, 2.10.1, 2.10.2, 2.10.3, 2.10.4, 2.10.5, 2.11.0, 2.11.1
-
Fix Version/s: None
-
Labels:
-
Epic Link:
Description
To reproduce:
1. Import and translate a modestly sized DNA dataset: - e.g.:
>a/1-23
ATGATGTATGTGTGTGTGTGTAT
>b/1-33
TTGTATCCCTGAATCATGCTAGCTAGAGAGTAG
2. Move the mouse around - note mouse highlight updates are not instantaneous (perhaps 0.15s ?).
3. Create a new view on the splitframe and eXpand it.
4. try the mouse highlighting again - I see a distinctl increase in the delay between moving the mouse and the status bar and black highlight regions being updated.
Jvisualvm profiling suggests the Swing paint thread is taking longer (like much longer!). It looks to me like thread starvation - several windows being asked to update at once is causing lock contention which slows the paint thread.
1. Import and translate a modestly sized DNA dataset: - e.g.:
>a/1-23
ATGATGTATGTGTGTGTGTGTAT
>b/1-33
TTGTATCCCTGAATCATGCTAGCTAGAGAGTAG
2. Move the mouse around - note mouse highlight updates are not instantaneous (perhaps 0.15s ?).
3. Create a new view on the splitframe and eXpand it.
4. try the mouse highlighting again - I see a distinctl increase in the delay between moving the mouse and the status bar and black highlight regions being updated.
Jvisualvm profiling suggests the Swing paint thread is taking longer (like much longer!). It looks to me like thread starvation - several windows being asked to update at once is causing lock contention which slows the paint thread.
