Uploaded image for project: 'Jalview'
  1. Jalview
  2. JAL-4031

Reify mappings for ENA contigs reported as transcripts for retrieved Ensembl loci

    XMLWordPrintable

    Details

    • Type: Improvement
    • Status: Open
    • Priority: Blocker
    • Resolution: Unresolved
    • Affects Version/s: 2.11.2
    • Fix Version/s: 2.11.3
    • Component/s: cds/protein, genomes
    • Labels:
      None

      Description

      Some reference genomes available from Ensembl's API have ENA contigs as their transcripts, rather than native Ensembl transcripts.

      E.g. Fetching Tb927.3.3470 yields:
      >Tb927.3.3470/1-543 chromosome:TryBru_Apr2005_chr11:3:982589:983131:1
      ATGTTCGACTACCTTCTTTCCCTCTTGGGGTTGTTGAAGGAATGGCCACAATACACTCTGGATGACGTCCGG
      ...
      >AAZ10380/1-543 AAZ10380
      ATGTTCGACTACCTTCTTTCCCTCTTGGGGTTGTTGAAGGAATGGCCACAATACACTCTGGATGACGTCCGG
      ..

      In Jalview 2.11.2 (and earlier), it is then necessary to fetch the ENA record for AAZ10380 in order to provide access to protein products. This works, but the ENA contig doesn't actually retain a locus mapping to the original Tb927.3.3470 genomic sequence - preventing Genome/CDS/Protein traversal.

        Attachments

          Issue Links

            Activity

              People

              Assignee:
              jprocter Jim Procter
              Reporter:
              jprocter Jim Procter
              Votes:
              0 Vote for this issue
              Watchers:
              1 Start watching this issue

                Dates

                Created:
                Updated: