Details
-
Type: Improvement
-
Status: Open
-
Priority: Blocker
-
Resolution: Unresolved
-
Affects Version/s: 2.11.2
-
Fix Version/s: 2.11.3
-
Component/s: cds/protein, genomes
-
Labels:None
Description
Some reference genomes available from Ensembl's API have ENA contigs as their transcripts, rather than native Ensembl transcripts.
E.g. Fetching Tb927.3.3470 yields:
>Tb927.3.3470/1-543 chromosome:TryBru_Apr2005_chr11:3:982589:983131:1
ATGTTCGACTACCTTCTTTCCCTCTTGGGGTTGTTGAAGGAATGGCCACAATACACTCTGGATGACGTCCGG
...
>AAZ10380/1-543 AAZ10380
ATGTTCGACTACCTTCTTTCCCTCTTGGGGTTGTTGAAGGAATGGCCACAATACACTCTGGATGACGTCCGG
..
In Jalview 2.11.2 (and earlier), it is then necessary to fetch the ENA record for AAZ10380 in order to provide access to protein products. This works, but the ENA contig doesn't actually retain a locus mapping to the original Tb927.3.3470 genomic sequence - preventing Genome/CDS/Protein traversal.
E.g. Fetching Tb927.3.3470 yields:
>Tb927.3.3470/1-543 chromosome:TryBru_Apr2005_chr11:3:982589:983131:1
ATGTTCGACTACCTTCTTTCCCTCTTGGGGTTGTTGAAGGAATGGCCACAATACACTCTGGATGACGTCCGG
...
>AAZ10380/1-543 AAZ10380
ATGTTCGACTACCTTCTTTCCCTCTTGGGGTTGTTGAAGGAATGGCCACAATACACTCTGGATGACGTCCGG
..
In Jalview 2.11.2 (and earlier), it is then necessary to fetch the ENA record for AAZ10380 in order to provide access to protein products. This works, but the ENA contig doesn't actually retain a locus mapping to the original Tb927.3.3470 genomic sequence - preventing Genome/CDS/Protein traversal.
Attachments
Issue Links
- depends on
-
JAL-4032 ENA contigs with valid Ensembl cross-references do not get annotated with their genomic locus
- Open